Тонзиллит от золотистого стафилококка


Стафилококковый тонзиллит (ангина) - симптомы и лечение

Стафилококковый тонзиллит – одна из наиболее тяжелых форм ангины, которая требует длительного лечения. Болезнь чревата различными осложнениями.

Выявить патологию поможет тщательная диагностика, после чего потребуется курс антибактериальной терапии, усилить действие медикаментов помогут средства нетрадиционной медицины.


СодержаниеПоказать

Причины стафилококкового тонзиллита

Существует много различных штаммов стафилококка, но причиной развития бактериальной ангины, ринита, синусита и других заболеваний органов дыхательной системы является только золотистый стафилококк. Инфекции эти заразные, передаются воздушно-капельным путем.

Микроб относится к условно-патогенным микроорганизмам, поэтому его присутствие не всегда означает болезнь, но существуют определенные провоцирующие факторы, которые способствуют активному росту бактерий, что и приводит к возникновению воспалительных процессов миндалин.

Почему возникает стафилококковая ангина:

  • ослабленный иммунитет – недавняя простуда, грипп, оперативное вмешательство;
  • стрессы, усталость, хроническое недосыпание;
  • контакт с носителем инфекции;
  • курение;
  • кариес, заболевания десен;
  • длительный прием антибактериальных препаратов;
  • переохлаждение, вдыхание холодного, загрязненного воздуха;
  • аутоиммунные патологии, сахарный диабет;
  • злоупотребление диетами, на фоне которых развивается авитаминоз, дефицит аминокислот, минералов.

Стафилококковый тонзиллит – редкая патология, на ее долю приходится не более 10% случаев острой бактериальной ангины, но именно эта разновидность заболевания чаще всего приобретает хронический характер.

Симптомы заболевания

При поражении миндалин золотистым стафилококком возникает ряд характерных признаков, которые проявляются обычно через 24–48 часов после заражения, сохраняются на протяжении 5–8 суток.

Признаки стафилококкового тонзиллита:

  • резкое повышение температуры до 38,5 и более градуса, озноб, лихорадка, сильная головная боль, у детей могут возникнуть судороги нижних конечностей;
  • слизистая оболочка нёба, миндалин и язычка становится ярко-красной;
  • быстро увеличиваются в размерах подчелюстные лимфатические узлы, при легком надавливании на них возникает сильная, резкая боль;
  • на поверхности гланд появляется налет белого или желтого цвета, в лакунах скапливаются гнойные бляшки, которые попадают в ротовую полость при откашливании, после полоскания горла;
  • на слизистой миндалин появляются пузырьки, которые заполнены гноем;
  • сильная боль при глотании;
  • неприятный, гнилостный запах изо рта;
  • кожа становится бледной.

Золотистый стафилококк в процессе своей жизнедеятельности выделяет много токсичных веществ, что провоцирует сильную интоксикацию организма при тонзиллите – проявляется это в виде слабости, снижении аппетита, тошноты, суставной и мышечной боли, расстройства стула.

Стафилококковая ангина у детей

Золотистый стафилококк поражает детей чаще, нежели взрослых – это связано с несовершенной иммунной системой ребенка, частыми близкими контактами с носителями инфекции.

Автор:

Трофимова Ирина

Не разобрался в материале статьи или нужна помощь? Задай вопрос сейчас и получи на него ответ.

Задать вопрос автору

Ангина и другие стафилококковые инфекции поражают детей преимущественно в возрасте 5–15 лет, заболевания протекают в тяжелой форме, часто сопровождаются осложнениями, часто ребенку требуется госпитализация.

Симптомы стафилококкового тонзиллита у детей:

  • вялость, слабость, беспокойство, резкое повышение температуры, иногда даже до 40 градусов, потеря или спутанность сознания;
  • рвота, диарея;
  • конъюнктивит;
  • появление серой пленки, которая полностью покрывает миндалины – удалять ее самостоятельно категорически запрещено, чтобы не спровоцировать распространение инфекции по всему организму;
  • слизистая горла сильно воспаляется, отекает;
  • миндалины становятся рыхлыми и бугристыми, на их поверхности появляется много язв и гнойников;
  • сильная боль в горле, которая отдает в ухо, шею, височную область.

Если характерные симптомы стафилококковой ангины появляются во время беременности, женщину срочно госпитализируют – патогенный микроб способен проникать сквозь плаценту, что может стать причиной заражения или гибели плода, задержки развития, врожденных патологий.

Диагностика стафилококкового тонзиллита

По внешним признакам невозможно определить, что ангина вызвана именно стафилококками, поскольку практически все формы тонзиллита имеют схожую клиническую картину. Только на основании результатов лабораторных исследований можно судить о типе возбудителя патологии.

Опытный врач способен сделать первые выводы о природе тонзиллита по внешнему виду горла:

Основные методы диагностики стафилококкового тонзиллита:

  • общий и клинический анализ мочи – позволяет обнаружить признаки воспалительного процесса, оценить состояние внутренних органов;
  • окрашивание биологического материала по методу Грамма – золотистый стафилококк приобретает синий оттенок;
  • бактериальный посев мазка из зева – позволяет определить тип возбудителя стафилококковой инфекции;
  • мазок из носа и зева на обнаружение дифтерийной палочки;
  • анализ сыворотки крови – проводят для выявления антител к стафилококку;
  • ПЦР диагностика – один из наиболее информативных методов обследования при стафилококковом тонзиллите, с его помощью можно определить тип микробов, давность заражения, стадию развития заболевания;
  • антибиотикограмма – проводят для определения чувствительности микробов к активным компонентам лекарственных средств;
  • иммунограмма – позволяет выявить причину развития иммунодефицита.

Чтобы выявить, насколько стафилококковая инфекция успела поразить другие органы, проводят УЗИ, ЭКГ, рентген.

Лечение стафилококковой ангины

В терапии стафилококкового тонзиллита применяют антибактериальные препараты, иммуномодуляторы, специфические лекарства, которые уничтожают непосредственно возбудителей заболевания.

Чем лечить стафилококковую ангину:

  1. Хлорофиллипт – один из лучших антисептиков, в виде спиртовой настойки применяют для полоскания горла, смазывания миндалин.
  2. Стафилококковый бактериофаг – лекарственное средство, содержит особые вирусы, которые способны уничтожат стафилококки. Препарат применяют для орошения гланд, раствором пропитывают ватные турунды, вставляют их в ноздри – так лекарство равномерно стекает по слизистой.
  3. Противостафилококковая плазма – средство получают из донорской крови, которую предварительно иммунизировали стафилококковым анатоксином, лекарство водят внутривенно, или используют для орошения носоглотки.
  4. Человеческий противостафилококковый иммуноглобулин – лекарство биологического происхождения, способствует быстрому восстановлению иммунитета, вводят его внутривенно через капельницу.

Антибактериальные препараты при стафилококковом тонзиллите назначают при сильной интоксикации, обильных гнойных выделениях, признаках некроза тканей. Но золотистый стафилококк устойчив ко многим антибиотикам, быстро вырабатывает иммунитет к активным веществам препарата.

Добиться выраженного терапевтического действия можно, комбинируя два препарата из группы пенициллинов, макролидов, цефалоспоринов в максимально допустимой дозировке, продолжительность лечения – не менее 10 дней.

После устранения острого воспалительного процесса врач может назначить физиопроцедуры – лазеротерапия, облучение ультрафиолетом, электрофорез с антисептиками, СВЧ.

Во время лечения стафилококкового тонзиллита необходимо пить больше теплой жидкости, чтобы помочь организму быстрее избавиться от токсинов. Дополнительно следует принимать витаминные комплексы, препараты для восстановления баланса кишечной микрофлоры.

Можно ли лечить стафилококковый тонзиллит народными средствами

Рецепты нетрадиционной медицины можно использовать в качестве вспомогательного метода терапии – они помогут укрепить иммунитет, устранить воспалительный процесс, но полностью заменять ими медикаменты при лечении стафилококкового тонзиллита нельзя.

Простые рецепты для лечения стафилококкового тонзиллита в домашних условиях:

  1. Смешать в равных пропорциях измельченные ягоды облепихи и корень лопуха, 15 г смесь заварить 200 мл кипятка, оставить в закрытой посуде на час. Процедить, выпить всю порцию лекарства небольшими глотками, процедуру повторять 2–3 раза в сутки до полного устранения признаков стафилококкового тонзиллита.
  2. К 200 г клюквы добавить 100 мл жидкого меда, тщательно перемешать, убрать в холодное место на час. Половину лекарства нужно съесть за полчаса до завтрака, оставшуюся часть – в течение дня небольшими порциями. Продолжительность терапии – 14 дней.
  3. Залить 250 мл кипятка 20 г измельченных плодов шиповника, через 3 минуты жидкость перелить в термос, оставить на полчаса. Добавить 15 мл меда, выпить всю порцию лекарства сразу, процедуру повторять 3–5 раз в день.

В качестве первой помощи при появлении симптомов стафилококкового тонзиллита можно полоскать горло маслом облепихи – это поможет несколько замедлить рост патогенных микроорганизмов, процедуру нужно проводить раз в 2 часа.

Насколько опасен стафилококковый тонзиллит

Если не начать своевременно лечение стафилококкового тонзиллита, инфекция с кровотоком разнесется по всему организму, могут пострадать различные внутренние органы.

Осложнения стафилококковой ангины:

  • пневмония, плеврит;
  • острый средний отит;
  • синусит;
  • абсцесс, некроз тканей;
  • асфиксия;
  • тяжелые сердечные патологии – миокардит, перикардит;
  • гломерулонефрит.

Наиболее опасное осложнение – сепсис, это заболевание сложно поддается лечению, часто заканчивается летальным исходом.

Стафилококковый тонзиллит – редкое, но очень опасное заболевание, на фоне которого часто развиваются сопутствующие патологии. Чтобы избежать инфекции, необходимо укреплять иммунную систему, отказаться от пагубных привычек, избегать переохлаждения.

Интересная информация о миндалинах, принципе их работы и бактериальном тонзиллите в видео:

При появлении первых признаков болезни необходимо обратиться к терапевту, педиатру или отоларингологу – самолечение, неправильный выбор препарата недопустимо.

Победить паразитов можно!

Антипаразитарный комплекс® - Надежное и безопасное избавление от паразитов за 21 день!

  • В состав входят только природные компоненты;
  • Не вызывает побочных эффектов;
  • Абсолютно безопасен;
  • Защищает от паразитов печень, сердце, легкие, желудок, кожу;
  • Выводит из организма продукты жизнедеятельности паразитов.
  • Эффективно уничтожает большую часть видов гельминтов за 21 день.

Сейчас действует акция на бесплатную упаковку. Читать мнение экспертов.


загрузка...

Золотистый стафилококк и хронический тонзиллит - Вопрос лору

Если вы не нашли нужной информации среди ответов на этот вопрос, или же ваша проблема немного отличается от представленной, попробуйте задать дополнительный вопрос врачу на этой же странице, если он будет по теме основного вопроса. Вы также можете задать новый вопрос, и через некоторое время наши врачи на него ответят. Это бесплатно. Также можете поискать нужную информацию в похожих вопросах на этой странице или через страницу поиска по сайту. Мы будем очень благодарны, если Вы порекомендуете нас своим друзьям в социальных сетях.

Медпортал 03online.com осуществляет медконсультации в режиме переписки с врачами на сайте. Здесь вы получаете ответы от реальных практикующих специалистов в своей области. В настоящий момент на сайте можно получить консультацию по 63 направлениям: аллерголога, анестезиолога-реаниматолога, венеролога, гастроэнтеролога, гематолога, генетика, гинеколога, гомеопата, дерматолога, детского гастроэнтеролога, детского гинеколога, детского дерматолога, детского кардиолога, детского лора, детского невролога, детского офтальмолога, детского психолога, детского пульмонолога, детского ревматолога, детского уролога, детского хирурга, детского эндокринолога, диетолога, иммунолога, инфекциониста, кардиолога, клинического психолога, косметолога, логопеда, лора, маммолога, медицинского юриста, нарколога, невропатолога, нейрохирурга, нефролога, нутрициолога, онколога, онкоуролога, ортопеда-травматолога, офтальмолога, паразитолога, педиатра, пластического хирурга, проктолога, психиатра, психолога, пульмонолога, ревматолога, рентгенолога, репродуктолога, сексолога-андролога, стоматолога, трихолога, уролога, фармацевта, физиотерапевта, фитотерапевта, флеболога, фтизиатра, хирурга, эндокринолога.

Мы отвечаем на 96.86% вопросов.

Оставайтесь с нами и будьте здоровы!

Тонзиллит золотистый стафилококк | | Лечение простуды

Стафилококковая ангина– заболевание довольно редкое. Считается, что на ее долю приходится около 10% случаев острого бактериального тонзиллита; при этом около 90% случаев представлено стрептококковой ангиной, и еще 10% — одновременным поражением миндалин стафилококком и стрептококком.

Внешне, без результатов лабораторных исследований, невозможно определить, что ангина стафилококковая – она имеет практически такие же проявления, как другие типы тонзиллита.

Несмотря на то, что стафилококк редко вызывает острый тонзиллит, зачастую именно он оказывается причиной хронического тонзиллита. Дело в том, что стафилококковый тонзиллит плохо поддается лечению «обычными» средствами от ангины. Даже антибиотики не всегда могут полностью уничтожить данный микроорганизм.

В данной статье мы расскажем всё, что вы хотели узнать о стафилококковой ангине – симптомы и лечение тонзилита, его особенности, диагностика, возможные осложнения.

Что же представляет собой стафилококк? Данный род микроорганизмов включает множество видов, большинство из которых не несут угрозы здоровью человеку. Вызывать инфекции могут всего 3 вида стафилококка – эпидермальный стафилококк, сапрофитный и золотистый.

Именно золотистый стафилококк может вызывать воспаление миндалин (ангину), а также другие острые респираторные заболевания верхних дыхательных путей – ринит, фарингит, синусит и др.

Золотистый стафилококк является условно патогенным микроорганизмом. Это значит, что его наличие в микрофлоре слизистой оболочки не всегда приводит к развитию болезни.

Известно, что большую

как лечится стафилококковая ангина, лечении тонзиллита, тонзиллит стафилококковый, признаки стафилококковой ангины у детей, золотистым стафилококком

Главный отличительный признак стафилококковой ангины – это образование на миндалинах плотного бактериального налета. Начинается заболевание остро, симптомы быстро нарастают, ухудшая общее самочувствие человека. Сопровождается она интоксикацией организма, сильной слабостью, апатией, выздоровление происходит медленно. Стафилококковая ангина имеет свою специфику, поэтому вылечить ее одними только антибиотиками получается не всегда. Каждый пациент рискует столкнуться с тяжелыми осложнениями и последствиями. При этой патологии, в отличие от иных видов ангины, опасно принимать антибиотики, так как это может повлечь за собой серьезное поражение сердца (эндокардит), сепсис.

Содержание статьи

Стафилококковая ангина

Данная форма тонзиллита вызывается золотистым стафилококком, болезнь наиболее тяжело протекает у детей. Иное называние – пленочная ангина. У детей старшего возраста и у взрослых носителей бактерии она встречается крайне редко.

В норме стафилококк присутствует в организме каждого человека, но достаточно крепкий иммунитет защищает от такого тяжелого поражения. Когда же появляются благоприятные условия для активации бактерии, то происходит инфицирование миндалин. Патология опасна, так как она может стать причиной дальнейших осложнений.

Лечится ангина антибактериальными препаратами. Основным фактором риска выступает ослабленный иммунитет у детей.

Профилактика заключается в укреплении иммунитета и повышении защитных сил организма.

Что такое стафилококки, причины заболевания

Стафилококк — это устойчивая патогенная бактерия, выживаемость которой на различных предметах составляет до полугода. Проникая в организм, она может вызвать патологию любого органа. Чаще всего от стафилококковой инфекции страдают кожа, глаза, слизистые оболочки.

Бактерия может атаковать человека в любом возрасте. Есть несколько известных инфекций, причиной которых она может стать.

Инфекционное воспаление в горле, вызванное стафилококком, протекает с несколько иными симптомами, но в целом клиническая картина каждой формы схожа.

Что может спровоцировать поражение организма стафилококком:

  • переохлаждение или перегрев, резкие перепады температуры;
  • непосредственный контакт с носителем инфекции;
  • состояния иммунодефицита человека;
  • привычки в питании, например, употребление большого количества сладостей;
  • частые волнения, депрессии, стрессы;
  • хроническая форма ангины с частыми рецидивами;
  • перенесенные ОРВИ или грипп.

Стафилококковый тонзиллит может возникать на фоне одного или нескольких перечисленных факторов. При этом бактериальная инфекция негативно сказывается не только на слизистой горла, на работе всего организма в целом.

В чем опасность стафилококковой ангины

Ангина, вызванная стафилококком, считается наиболее опасной для здоровья и сложной в плане лечения. Она может спровоцировать образование на горле, языке, слизистой рта язв и гнойников. Самым опасным считается тонзиллит стафилококковый, вызванный золотистым типом бактерии. Он способен вызвать ряд тяжелых осложнений, приводя к появлению высыпаний и гнойников не только на слизистой ткани, но и на коже лица, в глазах.

Неправильное и несвоевременное лечение становиться очевидным фактором сепсиса, заражения крови. Патология часто встречается в период вынашивания плода, а особенности лечения ангины при беременности не позволяют применять многих лекарств. Это чревато серьезными последствиями, угрожающими здоровью матери и ребенка.

Основные симптомы

Проявления болезни у ребенка или взрослого несколько отличаются. Признаки стафилококковой ангины у детей более выраженные. До момента появления первых симптомов после заражения проходит обычно не более двух суток.

У больного могут наблюдаться следующие симптомы:

  • температура тела повышается до 40 градусов;
  • появляется слабость, апатия, тревожат головные боли;
  • миндалины отечные, красные, покрыты налетом;
  • беспокоит тошнота, боль при глотании;
  • складки слизистой, миндалины приобретают бугристую форму;
  • увеличиваются регионарные лимфатические узлы;
  • аппетит слабый или отсутствует;
  • кожный покров становится бледным.

Активность возбудителя в дополнение приводит к мышечной боли, ломоте в теле, постоянной усталости. Боль в горле может отдавать в область виска, уха, шеи, в голову. Подобная симптоматика может нарастать в течение 7 дней.

Зачем нужны обследования при выявлении стафилококковой ангины

Основное исследование, которое поможет определить наличие стафилококка — это бактериальный посев мазка. Только он позволяет распознать возбудителя, определить его чувствительность к лекарствам. В дополнение могут назначаться другие методы диагностики.

Какие нужны обследования при выявлении стафилококковой ангины:

  1. Анализ крови для определения антител к бактерии. Стафилококк всегда присутствует в человеческом организме, поэтому на болезнь указывает превышение нормы антител.
  2. Полимеразная цепная реакция (ПЦР). Показывает наличие бактерии в самый короткий срок. Точный результат выдается на руки в день проведения.

Первичный осмотр пациента помогает увидеть воспалительный процесс в гортани, который характерен для любой формы ангины. Без проведения лабораторных анализов нельзя узнать возбудителя, поэтому перед лечением они назначаются в обязательном порядке.

Разновидности ангины, вызванной стафилококком

Чаще остальных диагностируются стрептококковые формы тонзиллита. Но и золотистый стафилококк может стать причиной нескольких видов болезни.

Виды заболевания:

  • язвенно-некротическая ангина — поражение глубоких слоев слизистой с их отмиранием, протекает наиболее тяжело;
  • лакунарная — образование гнойников, которые постепенно сливаются, образовывая специфический сетчатый рисунок;
  • фолликулярная — характеризуется острым началом с появлением на миндалинах многочисленных гнойников;
  • катаральная — гиперемия, отек и воспаление, то есть начальный этап патологии без образования гнойников.

Катаральная ангина имеет наиболее благоприятный прогноз, при своевременном лечении проходит быстро, без осложнений. Самой тяжелой формой является язвенно-некротический тонзиллит. Он сопровождается осложнениями, сильно ухудшает самочувствие больного.

Как и чем лечить стафилококковую ангину

Лечение тонзиллита, вызванного золотистым стафилококком, длительное и сложное. Подбор необходимого антибиотика проводится только после специальной лабораторной диагностики, так как этот тип бактерии устойчив ко многим лекарствам.

Лечение не ограничивается приемом антибактериальных препаратов, терапия включает комплекс мероприятий, направленных на профилактику осложнений. В обязательном порядке проводится обработка помещений, где находился больной.

Как лечится стафилококковая ангина:

  1. Антибиотики — чаще это группа цефалоспоринов или макролидов.
  2. Жаропонижающие — с содержанием парацетамола.
  3. Мочегонные — Фуросемид (при сильной отечности).
  4. Антисептические растворы для полоскания горла — Фурацилин, Хлорофиллипт.
  5. Иммуностимуляторы — Фарингосепт, Стрепсилс, Септолете.
  6. Витаминные и минеральные комплексы в таблетках.

Лечение при заражении золотистым стафилококком заключается в повышении сопротивляемости организма, поэтому необходимо изменить питание. Больному рекомендуется употреблять больше витаминной и белковой пищи, пить много жидкости, отказаться от тяжелых продуктов.

В домашних условиях можно использовать народные средства, но рассматриваются они только как вспомогательная мера. Это могут быть отвары трав для полоскания горла, настойки для приема внутрь с целью улучшения самочувствия.

Для полоскания горла можно использовать картофельный отвар, сок свеклы, отвары ромашки, шалфея. Чтобы уменьшить боль в горле, можно кушать мороженые продукты. Но пользу от этого лучше уточнять у лечащего врача, так как мнения специалистов по данной теме расходятся.

Симптомы тяжелой интоксикации снимаются обильным питьем, симптоматическими препаратами, в зависимости от проявлений и признаков. Для улучшения состояния больному прописывается постельный режим, отдых, не следует подвергаться стрессам, рекомендуется отказаться от алкоголя и сигарет.

При беременности, если ангина возникает относительно часто, основное лечение заключается в приеме антибиотиков, разрешенных во время вынашивания ребенка. Назначить их может только врач, самолечение запрещено.

Антибиотики для детей, как и при беременности, подбираются среди тех препаратов, которые вызывают минимум побочных реакций при прохождении курса.

Возможные последствия, осложнения

Стафилококковая ангина является причиной многих осложнений со стороны ЛОР-органов.

Ангина, спровоцированная стафилококком, может привести:

  • к воспалению и деструкции легких,
  • плевриту – патологии плевральной полости,
  • гломерулонефриту – поражению почек.

Самые опасные осложнения после ангины:

  • сепсис – системная воспалительная реакция в крови;
  • эндокардит – процесс воспаления внутри сердца.

Эти осложнения могут возникать даже на фоне приема антибактериальных препаратов.

Важно своевременно заметить симптомы ангины, сразу обращаться за помощью к врачу. Грамотная терапия в значительной мере снижает вероятность тяжелых осложнений. Самолечение в этом случае запрещается. Курс лечения обычно составляет до 14 дней, после чего специалист рекомендует план мероприятий в отношении профилактики повторного заражения.

Хронический тонзиллит золотистый стафилококк - Отоларингология

Кирилл Баранов (Мужчина, 18 лет)

Тонзиллит Золотистый стафилококк

Здравствуйте, уже как год болит горло, иногда сильнее, иногда слабее, посев в бак.лаборатории из зева показал staphylococcus aureus 10^7, язык и нос чистый. Делали промывание гланд Хлорофиллиптом, принимал антибиотики, было...

анонимно (Мужчина, 20 лет)

Хронический тонзиллит золотистый стафилококк Фронтит

Здравствуйте. 3 Месяца хронический тонзиллит - держится субфебрильная температура 37.2, Болит горло при глотании, не дышит нос и переодические головные боли. В зеве в горле нашли золотистый стафилококк, обильный. Общее...

анонимно

Золотистый стафилококк и кормление грудью

Добрый день! У меня вопрос по поводу грудного вскармливания. Я кормила дочь в общей сложности до 3 месяцев, молока было много. В 2 месяца мы сдали дочкин мазок из зева...

анонимно (Женщина, 28 лет)

Хлорофиллипт против золотистого стафилококка

Доброе время суток! Мне 28 лет, пол женский. 13 Лет назад поставлен диагноз хронический тонзиллит. На тот момент пролечили промываниями, может еще что то. Забыла на 11 лет о нем....

Марина Богданова (Женщина, 8 лет)

Аллергический ринит аденоиды 2 ст золотистый стафилококк

Началось все в 7 месяцев - гнойный отит слева, сопровождалось высокой температурой, лечили антибиотиками, потом в 1,5 года, к двум годам рецидивирующий гнойный средний отит, аллергический дерматит, выделен зелен.Стрептококк. Лечение...

анонимно

Золотистый стафилококк 10 в 8 в зеве ребенка

Здравствуйте. У дочери, 5 лет, обнаружен стафилококк 10 в 8 в горле. За 3 месяца до этого мы прошли лечение по поводу хронического тонзиллит и аденойдов.(миндалины наследственные рыхлые и гипертрофированные)...

анонимно

Золотистый стафилококк 10 в 8 в зеве у ребенка

Здравствуйте. У дочери, 5 лет, обнаружен стафилококк 10 в 8 в горле. За 3 месяца до этого мы прошли лечение по поводу хронического тонзиллит и аденойдов.(миндалины наследственные рыхлые и гипертрофированные)...

Обострение тонзиллита из-за золотистого стафилококка - Отоларингология

Кирилл Баранов (Мужчина, 18 лет)

Тонзиллит Золотистый стафилококк

Здравствуйте, уже как год болит горло, иногда сильнее, иногда слабее, посев в бак.лаборатории из зева показал staphylococcus aureus 10^7, язык и нос чистый. Делали промывание гланд Хлорофиллиптом, принимал антибиотики, было...

Рустэм Нигматуллин (Мужчина, 28 лет)

Золотистый стафилококк

Сдал анализ мазок из зева обнаружили золотистый стафилококк 10 в 5 степени. До сдачи анализов появился холецистит и множественные высыпания на лице и единичные прыщи на разных участках кожи в...

анонимно

Здравствуйте! У меня уже 3 года запах из носа. Иногда он усиливается так, что люди не могут со мной рядом находится, иногда (было всего 2 раза) почти исчезает. Я не...

анонимно

Золотистый стафилококк

Здравствуйте. Ребенку 15 лет, с января диагноз хронический тонзилит пролечились тонзилотреном физпроцедуры. С сентября постоянно субфебрильная темп, слабость,усталость. Обострение тонзилита, гнойные пробки, не исключают удаление миндалин. Промывали мирамистином 4 раза....

анонимно

Бакпосев из зева

Здравствуйте, Елена Владимировна. Меня зовут Елена, 29 лет. В детстве я часто болела ангинами, всегда лечилась под наблюдением врачей и, все-таки, как бонус получила хронический тонзиллит, да еще скрипящие коленки...

анонимно

Помогите справиться с хр. тонзиллитом

Добрый день! Помогите пожалуйста. В детстве мне поставили диагноз - хронический тонзиллит. Меня он никогда особо не беспокоил (2 ангины за 23 года, иногда были пробки небольшие, но горло не...

анонимно

Золотистый сиафилококк

Здравствуйте!Мне 18 лет.Недавно делала бак посев на наличие золотистого стафилококка из носа и рта. Результат 4 креста.При этом чувствую себя хорошо.Часто болею ОРВИ, ОРЗ. Также у меня хронический тонзиллит. Связано...

Staphylococcus aureus - microbewiki

Страница микробных биореалов по роду Staphylococcus aureus

Классификация

Таксоны высшего порядка

Домен: Бактерии Царство: бактерии Тип: Firmicutes Класс: Cocci Отряд: Bacillales Семья: Staphylococcaceae Род: стафилококк. Виды: Staphylococcus aureus

Виды

Золотистый стафилококк

Описание и значение

Стафилококки - это грамположительные бактерии сферической формы, которые неподвижны и образуют гроздья, похожие на виноградные.Они образуют пучки, потому что делятся в двух плоскостях, в отличие от своих близких родственников стрептококков, которые образуют цепочки, потому что разделяются только в одной плоскости. Колонии, образованные S. aureus , желтого цвета (отсюда и название aureus, латинское слово «золото») и увеличиваются в размерах на богатой среде. Staphylococcus aureus и их род Staphylococci являются факультативными анаэробами, что означает, что они растут за счет аэробного дыхания или ферментации, в результате которой образуется молочная кислота.

Как патоген, важно понимать механизмы вирулентности S.aureus , особенно устойчивый к метициллину Staphylococcus aureus (MRSA), чтобы успешно бороться с патогеном. Растущая популяция «супербактерий» и патогенов, устойчивых к антибиотикам, усилила давление на исследователей, заставляющих их искать альтернативные, более эффективные способы борьбы с этими «супербактериями». Секвенирование ДНК этого микроба уже позволило выделить исходный код его устойчивости к антибиотикам, и дальнейшие исследования, более чем вероятно, приведут нас на путь нашей следующей артиллерии против этого и многих других патогенов.

Структура генома

Геном Staphylococcus aureus , который является наиболее распространенным видом среди проектов генома Staphylococcus, представляет собой наиболее полную последовательность генома по сравнению с любыми другими видами микробов. Первоначальная карта генома Staphylococcus aureus была основана на штамме NCTC 8325, инициированном Питером А. Патти и его коллегами. К 2000 году весь геном штамма 8325 был секвенирован и аннотирован. С тех пор по крайней мере шесть других «С.aureus ’’ (COL, N315, Mu50, MW2, MRSA252, MSSA476).

Полная кольцевая карта генома штамма Staphylococcus aureus NCTC 8325 показывает ~ 2900 открытых рамок считывания, 61 ген тРНК, 3 структурных РНК и 5 полных оперонов рибосомной РНК. Этот штамм имеет около 33% содержания G + C и среднюю длину гена 824 нуклеотида с 85% кодирующей последовательностью, как и другие штаммы S. aureus . Половина кодирующей последовательности расположена преимущественно на одной репликоре, а вторая половина - преимущественно на другой реплиноре.

Факторы вирулентности кодируются фагами, плазмидами, островками патогенности и кассетной хромосомой стафилококка. Повышенная устойчивость к антибиотикам кодируется транспозоном (Tn 1546), который был вставлен в конъюгированную плазмиду, которая также кодировала устойчивость к другим вещам, включая дезинфицирующие средства. MRSA (Methicillin-Resistant Staphylococcus aureus ), устойчивый к антибиотику метициллину, экспрессирует модифицированный пенициллин-связывающий белок, кодируемый геном mecA.Это было вызвано многими эволюциями, которые считали, что горизонтальный перенос гена mecA на широкий спектр метициллин-чувствительных штаммов S. aureus . Гены устойчивости к антибиотикам в Staphylococcus aureus расположены на плазмидах или других подобных структурах.

Диверсификация в популяции S. aureus достигается за счет комбинации мутации, рекомбинации и горизонтального переноса генов. Эволюция этой бактерии может происходить в результате бессимптомной колонизации и / или в ходе вызванного заболевания.

Строение и метаболизм клеток

Staphylococcus aureus - это грамположительные бактерии, а это означает, что клеточная стенка этих бактерий состоит из очень толстого пептидогликанового слоя. Они образуют шарообразные колонии скоплениями в 2-х плоскостях и не имеют жгутиков.

Секреции многочисленны, но включают связанные с поверхностью адгезины, экзоферменты и капсульные полисахариды. Капсула отвечает за повышенную вирулентность мукоидного штамма.

Центральными путями метаболизма глюкозы являются путь Эмбдена-Мейерхоф-Парнаса (ЭМП) и пентозофосфатный цикл.Лактат - конечный продукт анаэробного метаболизма глюкозы, а ацетат и CO2 - продукты аэробных условий роста. S. aureus может поглощать различные питательные вещества, включая глюкозу, маннозу, маннит, глюкозамин, N-ацетилглюкозамин, сахарозу, лактозу, галактозу и бета-глюкозиды.

Экология

Staphylococcus aureus - один из наиболее распространенных патогенов, приобретаемых в больнице. Это нормальный обитатель кожи и слизистых оболочек носа здорового человека. S. aureus заразен как для животных, так и для человека и может выжить только на сухой коже. Он может распространяться через загрязненные поверхности, по воздуху и через людей. Примерно 30% нормального здорового населения поражено S. aureus , поскольку он бессимптомно колонизирует кожу человека-хозяина. Хотя некоторая колонизация хозяина может быть доброкачественной, прокол или разрыв кожи могут побудить эту бактерию проникнуть в рану и вызвать инфекции. Лучшая профилактическая мера - это просто регулярное мытье рук (желательно без антибактериального мыла и дезинфицирующих средств для рук, но это уже другая история) и ежедневное купание.

Патология

Staphylococcus aureus является наиболее частой причиной инфекций стафилококка и вызывает различные заболевания, включая: легкие кожные инфекции (импетиго, фолликулит и т. Д.), Инвазивные заболевания (раневые инфекции, остеомиелит, бактериемия с метастатическими осложнениями и т. Д.), и токсин-опосредованные заболевания (пищевое отравление, синдром токсического шока или СТШ, синдром чешуйчатой ​​кожи и т. д.). Инфекциям предшествует колонизация. Общие поверхностные инфекции включают карбункулы, импетиго, целлюлит, фолликулит.Внебольничные инфекции включают бактериемию, эндокардит, остеомилит, пневмонию и реже раневые инфекции. S. aureus также вызывает экономически важный мастит у коров, овец и коз.

В конце 1970-х годов эпидемия синдрома токсического шока (TSS T-1) была вызвана изменением среды обитания. Изменению окружающей среды способствовало создание современной технологии, известной также как супервпитывающий тампон. Этот новый современный продукт повседневного спроса, который охватил женщин страны, фактически создал новую, богатую питательными веществами поверхность, на которой могут размножаться многие бактерии, - S.aureus - крупный резидент. Тем не менее, TSS из тампонов можно легко избежать, правильно используя тампоны (прочтите инструкции и предупреждающие надписи, указанные на тампонных продуктах).

MRSA: Первое серьезное появление стафилококка, устойчивого к антибиотикам, произошло с конкретным штаммом, который мы называем устойчивым к метициллину Staphylococcus aureus , сокращенно MRSA. Этот штамм экспрессировал модифицированный пенициллин-связывающий белок, кодируемый геном mecA, и присутствует в 4 формах Staph.Кассетная хромосома. В конечном итоге был выделен MRSA, устойчивый к антибиотику метициллину. Следовательно, ванкомицин (самый мощный антибиотик в нашем арсенале) стал основным антибиотиком, используемым для борьбы с инфекцией стафилококка. В 1997 году был выделен штамм S. aureus , устойчивый к ванкомицину, и люди снова подвергаются угрозе неизлечимой инфекции стафилококка. Штаммы MRSA в настоящее время представляют собой очень серьезную проблему для здравоохранения. Секвенирование S.Мы надеемся, что геном aureus даст представление о том, как организм вырабатывает такое разнообразие токсинов, и поможет исследователям в разработке способов борьбы с универсальной бактерией.

Текущие исследования

Большая часть текущих исследований этой бактерии включает протеомику Staphylococcus aureus и MRSA. Устойчивость стафилококка к антибиотикам становится все более серьезной проблемой для современного общества, и необходимы дополнительные исследования, чтобы найти наше следующее «супер лекарство».

Существуют исследования, посвященные белкам стресса и голодания для прогнозирования физиологического состояния популяции клеток (7), чтобы мы могли лучше понять и найти другую тактику борьбы с этой бактерией.

Другое исследование, основанное на протеомике, направлено на объективное построение индекса экспрессии белка для различных штаммов S. aureus и выполнение сравнительного анализа различных штаммов в различных условиях роста (8). Методы достижения этого исследования возлагают большие надежды на разработку новых методов.

Также проводятся исследования по изучению приобретенного в больнице MRSA, связи между признаками вирулентности S. aureus и тем, получены ли изоляты из окружающей среды или от пациентов (9).

Список литературы

В. Чан, П. Шерман, Б. Бурк., Бактериальные геномы и инфекционные болезни (Тотова, штат Нью-Джерси: Humana Press, c2006).

Гилласпи, Уоррелл, Орвис и др. В грамположительных патогенах (ред. Фишетти, В., Новик, Р., Ферретти, Дж., Портной, Д. и Руд, Дж.) 381-410 (АСМ Пресс, Вашингтон , DC, 2006).

Р. Брукнер, Р. Розенштейн в грамположительных патогенах (ред. Фишетти, В., Новик, Р., Ферретти, Дж., Портной, Д. и Руд, Дж.) 427-451 (ASM Press, Вашингтон, США). Д.C, 2006). Р. Новик в грамположительных патогенах (ред. Фишетти, В., Новик, Р., Ферретти, Дж., Портной, Д. и Руд, Дж.) 496-510 (ASM Press, Вашингтон, округ Колумбия, 2006). Молнар, К., Хевесси, З., Розгоньи, Ф. и Геммелл, С. Г. Патогенность и вирулентность коагулазонегативных стафилококков в отношении адгезии, гидрофобности и продукции токсинов in vitro. J. Clin. Патол. 47, 743-748 (1994). http://tigr.org

http://www.ncbi.nlm.nih.gov

Курода, М. и др. 2001. Секвенирование всего генома метициллин-устойчивого Staphylococcus aureus .Ланцет, 357: 1225-1240

Скарр Е.П., Хумаюн М., Бэ Т. и др. 2004. Предпочтение источников железа при инфекциях, вызываемых Staphylococcus aureus. Наука, 305 (5690): 1626-8

http://www.kidshealth.org/parent/infections/bacterial_viral/staphylococcus.html

[Образец ссылки] Takai, K., Sugai, A., Itoh, T. и Horikoshi, K. « Palaeococcus ferrophilus gen. Nov., Sp. Nov., Барофильный гипертермофильный археон из глубинных месторождений. морской гидротермальный дымоход ". Международный журнал систематической и эволюционной микробиологии .2000. Том 50. с. 489-500.

Отредактировано ученицей Рэйчел Ларсен и Китом Польяно


КМГ

.

Биохимический и молекулярный анализ клинических изолятов Staphylococcus aureus у госпитализированных пациентов

Staphylococcus aureus является условно-патогенным микроорганизмом человека, а также животным, вызывающим множество заболеваний. Всего было получено 100 изолята Staphylococcus aureus из клинических образцов, взятых у госпитализированных пациентов. Предполагаемые клинические изоляты Staphylococcus aureus были фенотипически идентифицированы с помощью различных биохимических тестов.Молекулярная идентификация была проведена с помощью ПЦР с использованием видоспецифичных пар праймеров 16S рРНК и, наконец, 100 изолятов оказались положительными как Staphylococcus aureus . Отобранные изоляты были дополнительно проанализированы с помощью нескольких тестов микробиологической диагностики, включая тесты на гидролиз желатина, протеазу и липазу. Было обнаружено, что 78%, 81% и 51% изолятов были положительными по гидролизу желатина, протеазной и липазной активности соответственно. Анализ антибиотикограмм выделенных штаммов Staphylococcus aureus по отношению к различным антимикробным агентам выявил характер резистентности от 57 до 96%.Наше исследование также показывает, что 70% штаммов принадлежат к MRSA, 54,3% - к VRSA и 54,3% - к MRSA и VRSA. Все идентифицированные изоляты были подвергнуты обнаружению генов mec A, nuc и hlb , и было обнаружено, что 70%, 84% и 40% содержат mec A, nuc и hlb . гены соответственно. Текущее исследование очень важно и информативно для инфекций Staphylococcus aureus с высокой степенью множественной лекарственной устойчивости, включая также метициллин и ванкомицин.

1. Введение

Staphylococcus aureus - один из наиболее вредных видов стафилококков. Это основная причина бактериемии, пневмонии, миокардита, острого эндокардита, перикардита, остеомиелита, энцефалита, менингита, хориоамнионита, мастита и синдрома ожоговой кожи [1]. Заболеваемость и смертность людей в больничных условиях в значительной степени вызваны стафилококковой бактериемией [2]. Патогенная способность Staphylococcus aureus явно зависит от продукции экзопротеинов и токсинов.Вид идентифицируется на основе множества общепринятых физиологических или биохимических признаков. Ключевыми признаками для Staphylococcus aureus являются пигмент колонии, свободная коагулаза, фактор слипания, белок А, термостабильная нуклеаза, липаза и продукция кислоты из маннита [1]. Кроме того, Staphylococcus aureus можно идентифицировать методами ПЦР. Сообщается, что ген 16S рРНК является наиболее полезным и широко изученным таксономическим маркером [3].

Из-за чрезмерного и неконтролируемого использования антибиотиков организм становится множественной лекарственной устойчивостью, оставляя мало терапевтических возможностей для лечения против него [4].Появление метициллин-резистентного Staphylococcus aureus (MRSA) при внутрибольничных (HA) инфекциях подчеркивает, что этот вид является потенциальным патогеном, способным бороться с антимикробным агентом [5]. Ген mec A [6, 7] синтезирует пенициллин-связывающий белок (PBP2a) и является причиной устойчивости к метициллину у MRSA. Этот ген находится на стафилококковой кассетной хромосоме (SCC) [8]. Кассетная стафилококковая хромосома - крупный генетический мобильный элемент, который различается по размеру и генетическому составу среди штаммов MRSA [9].Колонизированный персонал больниц и инфицированные пациенты являются основным источником MRSA [10]. Знания о выборе антибиотиков для лечения важны, так как картина чувствительности MRSA к антибиотикам может варьироваться от региона к региону [11]. Для лечения стафилококковых инфекций использовались различные классы антибиотиков, включая бета-лактамы, гликопептиды, липопептиды, оксазолидоны, аминогликозиды, макролиды и фторхинолоны [12–15]. Устойчивость стафилококков возникает к различным антимикробным препаратам, а также к ванкомицину.Следовательно, устойчивость к ванкомицину - еще одна проблема для лечения инфекций, вызываемых этой бактерией [16].

Настоящая работа была запланирована для идентификации и характеристики изолятов Staphylococcus aureus , собранных из мазка из послеоперационной раны пациентов мужского и женского пола, госпитализированных в различные отделения Медицинского колледжа и больницы Миднапура, Миднапор, Западная Бенгалия, Индия. Цели настоящего исследования состояли в том, чтобы выяснить уровень устойчивости к MRSA и ванкомицину Staphylococcus aureus (VRSA) при внутрибольничных инфекциях и определить характер ответа на антибиотики.

2. Материалы и методы
2.1. Бактериальные изоляты и методы культивирования

С января 2013 г. по октябрь 2014 г. в мужских хирургических палатах, ортопедическом отделении и отделении ожогов и ран Медицинского колледжа и больницы Миднапора, Миднапор, Западная Бенгалия, Индия, было собрано в общей сложности 165 недубликатных бактериальных изолятов. . Были включены только штаммы, полученные из чистой культуры. Был включен только первый штамм от каждого пациента. Все штаммы были собраны в асептических условиях, перенесены в среду с маннитоловым агаром (MSA), HiMedia (Mumbai) и инкубированы в течение ночи при 37 ° C [17].

2.2. Выделение и фенотипическая идентификация Staphylococcus aureus

Каждый выделенный бактериальный образец из среды MSA сначала оценивали на 5% агаре с овечьей кровью и инкубировали в течение ночи при 37 ° C. Каждая культура подвергалась окрашиванию по Граму и тестировалась на продукцию каталазы, свободной коагулазы, желтого пигмента и термонуклеазы (TNase), согласно Lancette и Tatini [18].

2.3. Молекулярная идентификация с помощью ПЦР-амплификации гена

рРНК 16S. Бактериальные изоляты, которые, как было установлено, были Staphylococcus aureus по определенным фенотипическим признакам, были дополнительно протестированы с помощью ПЦР для подтверждения с использованием конкретных пар праймеров 16S рРНК (таблица 1).Эти праймеры амплифицируют участок длиной 228 п.о. фрагмента гена 16S рРНК Staphylococcus aureus , который является высококонсервативным на уровне видов. Программирование ПЦР было начато с начальной стадии денатурации при 94 ° C в течение 2 минут, за которыми следовали 35 циклов при 94 ° C в течение 30 секунд, 50 ° C в течение 30 секунд и 72 ° C в течение 45 секунд, заканчивая конечной стадией расширения в 72 ° C в течение 4 мин. S. aureus ATCC 25923 использовали в качестве положительного контроля в этом эксперименте.


Праймер Направление Последовательности (5'-3 ') Размеры ампликона (bp) Ссылка

16S рРНК F GTA GGT GGC AAG CGT TAT CC 228 [19]
R CGCACATCAGCGTCAG

mec A F GTG AAG ATA TAC CAA GTG ATT 147 [20]
R ATG CGC TAT AGA TTG AAA GGA T

nuc F GCGATTGATGGTGATACGGTT 270 [21]
R AGCCAAGCCTTGACGAACTAAAGC

глб F GTGCACTTACTGACAATAGTGC 309 [22]
R GTTGATGAGTAGCTACCTTCAGT

2.4. Биохимическая характеристика Staphylococcus aureus Штаммы

Штаммы бактерий, которые были подтверждены как Staphylococcus aureus при видоспецифическом скрининге 16S рРНК, были дополнительно проанализированы с помощью нескольких микробиологических диагностических тестов, включая ферментацию маннита и рост при высокой концентрации соли, гидролиз желатина, гидролиз мочевины, протеазная активность на агаровой среде с молоком, продукция липазы на агаровой среде с яичным желтком (HiMedia, Мумбаи) и гидролиз эскулина стандартными методами [23–26].Гемолитическую активность определяли на агаре с овечьей кровью (15 мл 5% овечьей крови в триптиказо-соевом агаре наложили на 10 мл основы кровяного агара) согласно Rodgers et al. [27].

2,5. Профиль чувствительности к антибиотикам изолированного Staphylococcus aureus к некоторым противомикробным агентам и обнаружение VRSA

Чувствительность изолятов Staphylococcus aureus к различным антимикробным агентам определяли методом дисковой диффузии с использованием коммерческих дисков, полученных от HiMedia [28].Антимикробные диски были следующими: ампициллин (30 мкг г), стрептомицин (10 мкг г), канамицин (30 мкг г), эритромицин (10 мкг г), хлорамфеникол (30 мкг г). ), цефокситин (30 мкл г), налидиксовая кислота (30 мкл г) и новобиоцин (30 мкг г). Клинические штаммы были классифицированы как чувствительные и резистентные в соответствии с критериями оценки, разработанными в соответствии с рекомендациями Института клинических и лабораторных стандартов (CLSI) [29].Чтобы идентифицировать VSSA и VRSA, МИК ванкомицина определяли методом разведения микробов с использованием бульона Мюллера-Хинтона в соответствии с рекомендациями Института клинических лабораторных стандартов [29]. Staphylococcus aureus ATCC 29213 использовали в качестве чувствительных к ванкомицину контролей и Enterococcus faecalis ATCC 51299 в качестве резистентных к ванкомицину контролей.

2.6. Обнаружение mec A, nuc и hlb Гены

Staphylococcus aureus изолятов были подвергнуты обнаружению mec A, nuc и hlb пар специфичных генов с использованием ПЦР Таблица 1).Амплификацию проводили в термоциклере (Eppendorf, Германия), начиная с начальной стадии денатурации при 95 ° C в течение 2 минут, затем следовали 35 циклов при 94 ° C в течение 1 минуты, 55 ° C в течение 45 секунд, 50 ° C в течение 50 секунд. и 52 ° в течение 40 секунд для гена mec A, nuc и hlb , соответственно, и обычное удлинение при 72 ° C в течение 2 минут, заканчивающееся этапом окончательного удлинения при 72 ° C в течение 4 минут. . Для быстрой экстракции ДНК из Staphylococcus aureus от одной до пяти бактериальных колоний суспендировали в 50 мкл л стерильной воды Milli Q (Millipore-Synergy®, Индия) и нагревали при 99 ° C в течение 10 мин в 500 мк . L трубка Эппендорфа.После центрифуги при 14000 об / мин. В течение 10 мин в мини-центрифуге (Eppendorf, Германия) 2 мкл л супернатанта использовали в качестве матрицы.

3. Результаты

В настоящем исследовании у госпитализированных пациентов было собрано 165 недупликативных образцов. Из 165 образцов 100 штаммов (60,60%) были выделены из селективной среды MSA, а затем эти изоляты были идентифицированы на Staphylococcus aureus с помощью различных биохимических тестов (таблица 2). Окрашивание по Граму, каталаза, коагулаза и термонуклеаза были важными фенотипическими маркерами идентификации Staphylococcus aureus .В этом исследовании мы обнаружили, что 100%, 92% и 84% изолятов были положительными по каталазе, коагулазе и термостабильной нуклеазе соответственно (таблица 2). Все изоляты Staphylococcus aureus (100) в этом исследовании были подтверждены с помощью ПЦР с использованием пары видоспецифичных праймеров (Таблица 1). Фермент желатиназа секретируется Staphylococcus aureus , разжижающим желатиновый белок. Настоящее исследование также показало, что 78% изолятов Staphylococcus aureus были способны продуцировать желатиназу.В таблице 3 81%, 51% и 48% выделенных штаммов продуцировали протеазу, липазу и колонии с небелым пигментом, соответственно. Настоящее исследование показало, что 40% изолятов Staphylococcus aureus были способны образовывать очищающую зону вокруг их роста на среде с кровяным агаром (таблица 4), демонстрируя, что они могут продуцировать гемолизин. Показатели устойчивости Staphylococcus aureus варьировались от 57 до 96%. Устойчивость изолятов Staphylococcus aureus к ампициллину (96%), цефокситину (70%), канамицину (74%), эритромицину (81%), стрептомицину (75%), налидиксовой кислоте (89%), новобиоцину (75%) , и хлорамфеникол (57%) (таблица 5).Было обнаружено, что все штаммы Staphylococcus aureus , выделенные в этом исследовании, обладают множественной лекарственной устойчивостью. В настоящем исследовании мы обнаружили, что уровень распространенности MRSA составляет 70%. Наше исследование также показало, что 54,3% выделенных Staphylococcus aureus были устойчивыми к ванкомицину (Таблица 6), а 54,3% устойчивых к метициллину Staphylococcus aureus были устойчивы к ванкомицину. Согласно руководству CLSI [29] штаммы, имеющие МИК ванкомицина 4–8 мкг мкг / мл, были промежуточными по ванкомицину Staphylococcus aureus .Далее мы обнаружили, что 38,6% штаммов были промежуточными по ванкомицину Staphylococcus aureus . Все фенотипически идентифицированные метициллин-устойчивые штаммы Staphylococcus aureus (MRSA) обладали геном mec A. Внеклеточная термостабильная эндонуклеаза (TNase), которая разрезает как ДНК, так и РНК, была продуцирована Staphylococcus aureus , характеризующимся своим геном nuc , специфичным для Staphylococcus aureus [21]. Было обнаружено, что восемьдесят четыре% штаммов содержат ген nuc .ПЦР-анализ также выявил 40 штаммов, несущих ген hlb , ответственный за бета-гемолиз.


Источник изолятов Количество исследованных образцов Количество изолятов S. aureus Колонический пигмент Окрашивание по Граму
Число (%)
Активность каталазы
Количество (%)
Коагулазная активность
Число (%)
Активность Tnase
Число (%)
Белый Кремовый Желтый
Число (%) Число (%) Число (%)

Хирургическое отделение для мужчин 80 45 5 (11) 15 (33) 25 (55) 45 (100) 45 (100) 42 (93) 37 (83)
Ортопедическая палата 70 50 18 (36) 12 (24) 20 (40) 50 (100) 50 (100) 45 (90) 42 (83)
Ожог и рана Раздел 15 5 0 (0) 2 (40) 3 (60) 5 (100) 5 (100) 5 (100) 5 (100)
Всего 165 100 23 (23) 29 (29) 48 (48) 100 (100) 100 (100) 92 (92) 84 (84)

Положительное число; процент указан в скобках.

Источник изолятов Ферментация маннита с высокой концентрацией соли Активность желатиназы
Количество (%)
Активность уреазы
Количество (%)
Активность протеазы
Количество (%)
Продукция липазы
Количество (%)
Гидролиз эскулина
Число (%)
Число (%)

Хирургическое отделение для мужчин 45 (100) 33 (73) 34 (76) 36 (80 ) 22 (49) 5 (11)
Ортопедическое отделение 50 (100) 40 (80) 35 (70) 41 (82) 25 (50) 5 (10)
Отделение ожогов и ран 5 (100) 5 (100) 4 (80) 4 (80) 4 (80) 0 (0)
Всего 100 (100) 78 (78) 73 (73) 81 (81) 51 (51) 10 (10)

Положительное число; процент указан в скобках.

Источник изолятов Число исследованных образцов Alpha Beta Гамма
Число (%) Число (%) Число (%)

Хирургическое отделение для мужчин 45 25 (56) 15 (33) 5 (11)
Ортопедическое отделение 50 18 ( 36) 20 (40) 12 (24)
Участок ожогов и ран 5 0 (0) 5 (100) 0 (0)
Итого 100 43 (43) 40 (40) 17 (17)

Положительное число; процент указан в скобках.
hen

Антибиотики % резистентность % чувствительность

Ампициллин (30 мкг) 96 4
Ch. 30 мкг) 57 53
Стрептомицин (10 мкг) 75 25
Эритромицин (10 мкг) 81 19
Канамицин (30 мкг) 74 26
Налидиксовая кислота (30 мкг) 89 11
Новобиоцин (30 мкг) 75 25
Цефокситин (30 мкг) 70 30


Vanc МИК для омицина ( μ г / мл) MRSA () MSSA ()
VSSA
Число (%)
VISA
Число (%)
VRSA
Число (%)
VSSA
Число (%)
VISA
Число (%)
VRSA
Число (%)

0.25 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
0,5 3 (4,28) 0 (0) 0 (0) 18 (60) 0 (0) 0 (0)
1 2 (2,85) 0 (0) 0 (0) ) 12 (40) 0 (0) 0 (0)
2 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
4 0 (0) 10 (14.3) 0 (0) 0 (0) 0 (0) 0 (0)
8 0 (0) 17 (24,3) 0 (0) 0 (0) 0 (0) 0 (0)
16 0 (0) 0 (0) 36 (51,4) 0 (0) 0 ( 0) 0 (0)
32 0 (0) 0 (0) 2 (2,9) 0 (0) 0 (0) 0 (0)
Итого 5 (7.1) 27 (38,6) 38 (54,3) 30 (100) 0 (0) 0 (0)

Положительное число; процентное соотношение указано в скобках; VSSA: чувствительный к ванкомицину Staphylococcus aureus ; VISA: промежуточный ванкомицин Staphylococcus aureus ; VRSA: устойчивый к ванкомицину Staphylococcus aureus ; MRSA: метициллин-устойчивый Staphylococcus aureus ; MSSA: метициллин-чувствительный Staphylococcus aureus .
4. Обсуждение

В настоящем исследовании в общей сложности 100 (60,60%) изолятов клинических бактериальных образцов из мужских хирургических отделений, ортопедического отделения и отделения ожогов и ран Медицинского колледжа и больницы Миднапура, Миднапур, США. Западная Бенгалия, Индия, была подтверждена как Staphylococcus aureus . Виджаялакшми [30] сообщил, что инфекция области хирургического вмешательства, вызванная Staphylococcus aureus , обнаружена в 43,2% случаев в Хайдарабаде, Индия. Окрашивание по Граму, каталаза, коагулаза и термонуклеаза были важными фенотипическими маркерами идентификации Staphylococcus aureus [1].В этом исследовании мы обнаружили, что 92% изолятов были коагулазо-положительными, но остальные штаммы были коагулазо-отрицательными, хотя было обнаружено, что они представляют собой Staphylococcus aureus , что подтверждено анализом ПЦР с использованием праймеров 16S рРНК, специфичных для этого вида. Этот результат коррелирует с данными Кормана [31]. Мэтьюз и др. и Rukumani et al. [32, 33] также обнаружили атипичный коагулазонегативный Staphylococcus aureus из пищевых продуктов и клинических образцов, соответственно. Sanford et al.[34] сообщили, что большинство клинических штаммов Staphylococcus aureus , ассоциированных с пневмонией, продуцировали термостабильные ДНКазы (88%) и протеазы (94%). Настоящее исследование показало, что 84% и 81% клинических штаммов продуцируют термостабильные ДНКазы и протеазы соответственно. Staphylococcus aureus , устойчивые к метициллину, представляют собой опасные для жизни бактерии в больничных условиях [5]. Исследования показывают, что большинство штаммов MRSA связано с внутрибольничной колонизацией и инфекциями [35].Все штаммов Staphylococcus aureus выделены в

.

% PDF-1.4 % 117 0 объект > endobj 118 0 объект > поток D: 20045304135355Apex PDFWriter2020-11-09T02: 28: 48-08: 002020-11-09T02: 28: 48-08: 00uuid: 7a9e0bfb-1dd2-11b2-0a00-4009275dc400uuid: 7a9e0bfe-1dd21000000bdf2-0aapplication / конечный поток endobj 1 0 obj > endobj 4 0 obj > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 8 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 12 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 16 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 20 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 24 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 29 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 33 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 37 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 41 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 45 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 49 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 53 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 57 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 61 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 65 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 69 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 73 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 77 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 81 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 85 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 89 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 93 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 97 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 101 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 105 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 109 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 113 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 174 0 объект [176 0 R] endobj 175 0 объект > поток HWYo ~ ׯ] Л8; p։ ڣ 9 鑳 O * 9R / b, V} WJi8bQ {/ W7W? ^> \ Yju;, k? + Bu {T Ҍa: pu8toC / x] ۆ tM lzZKG3) T ​​[ kXT: ÅƮS B5> "- '/ v ݵ ~ LNi {ė * _ħ | HEB1x} SōMxә? 㤝 x NV ջ s3OCiq! nvd O> $ MTXWzԝ} 7p9> TI-I4 ‘! msl + 6iX = m s3 = TZcMZ2C̨Fj4ivvliHpkƉc3} ¯7L) MSJ @ vMqD | 07}) 焽 vf # f! 9L "^] c ب:% 룏 jðoo2vl | h * e \ P) c # L * K!" MMsKn4qs & 9lKŷ 4 $ Pe2 ލMB: $ c «kSv, ̓ * 1Y +, & dpg61P``gT \ Dd6hGyw *? * Qbns.$ Ԇ / pƋ #

.

Staphylococcus aureus subsp. aureus Rosenbach ATCC ® 6538 ™

Выбрать другую страну:

USACanadaAfghanistanAlbaniaAlgeriaAndorraAngolaAntigua & BarbudaArgentinaArmeniaArubaAustraliaAustriaAzerbaijanBahamasBahrainBangladeshBarbadosBelarusBelgiumBelizeBeninBermudaBhutanBoliviaBosnia-HerzegovinaBotswanaBrazilBruneiBulgariaBurkina FasoBurundiCambodiaCameroonCape VerdeCayman IslandsCentral Африканский RepublicChadChileChinaColombiaComorosCongoCongo, Демократическая RepublicCosta RicaCote д "IvoireCroatiaCuracaoCyprusCzech RepublicDenmarkDjiboutiDominicaDominican RepublicEcuadorEgyptEl SalvadorEngland, У.K.Equatorial GuineaEritreaEstoniaeSwatiniEthiopiaFijiFinlandFranceFrench GuianaGabonGambiaGeorgiaGermanyGhanaGreeceGrenadaGuadeloupeGuamGuatemalaGuernseyGuineaGuinea-BissauGuyanaHaitiHondurasHong KongHungaryIcelandIndiaIndonesiaIrelandIsraelItalyJamaicaJapanJerseyJordanKazakhstanKenyaKiribatiKosovoKuwaitKyrgyzstanLaosLatviaLebanonLesothoLiberiaLibyaLiechtensteinLithuaniaLuxembourgMacauMacedoniaMadagascarMalawiMalaysiaMaldivesMaliMaltaMarshall IslandsMauritaniaMauritiusMexicoMicronesiaMoldova, Республика ofMonacoMongoliaMontenegroMoroccoMozambiqueMyanmarNamibiaNauruNepalNetherlandsNew CaledoniaNew ZealandNicaraguaNigerNigeriaNorthern Ирландия, U.K.Северные Марианские островаНорвегияОманПакистанПалауПанамаПапуа-Новая ГвинеяПарагвайПеруФилиппиныПольшаПортугалияКатарРеюньонРумынияРоссияРуандаСабаСан-МариноСао-Томе и ПринсипиСаудовская АравияШотландия, Соединенное Королевство, Словакия, Сенегал, Сербия, Сибирь, Ломонанка, Словакия, Южная Корея, Сербия, Южная Корея Китс и Невис LuciaSt. Винсент и Гренадин Суринам Швеция 9000 5.

Смотрите также